View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7500_high_3 (Length: 220)
Name: NF7500_high_3
Description: NF7500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7500_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 194
Target Start/End: Complemental strand, 32178945 - 32178753
Alignment:
| Q |
2 |
aagaaataaacataagcacgcttacttgggaagatcgcaaccgtgaggctgccaccgcaaccggcggtactctttatccggccggccatgttcttgacaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32178945 |
aagaaataaacataagcacgcttacttgggaagatcgcaaccgtgaggctgccaccgcaaccggcggtactctttatccggccggccatgttcttgacaa |
32178846 |
T |
|
| Q |
102 |
gtcaactgtggttgtatatacggacactcagattcttcatataatggccgtgtcaactcatctttcacccacgttccactaaacaaatcacac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32178845 |
gtcaactgtggttgtatatacggacactcagattcttcatataatggccgtgtcaactcatctttcacccacgttccactaaacaaatcacac |
32178753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 136
Target Start/End: Complemental strand, 35940156 - 35940042
Alignment:
| Q |
22 |
cttacttgggaagatcgcaaccgtgaggctgccaccgcaaccggcggtactctttatccggccggccatgttcttgacaagtcaactgtggttgtatata |
121 |
Q |
| |
|
||||||| ||||||||||||||||| || ||||||| | | | |||| ||||| || || | ||||||||||| |||||||| ||||||||||| || |
|
|
| T |
35940156 |
cttacttaggaagatcgcaaccgtgtggttgccacctccaatgttggtaatctttgtcgggtctcccatgttcttggcaagtcaattgtggttgtatgta |
35940057 |
T |
|
| Q |
122 |
cggacactcagattc |
136 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
35940056 |
cggacactctgattc |
35940042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University