View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7503_high_13 (Length: 237)
Name: NF7503_high_13
Description: NF7503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7503_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 36363871 - 36363986
Alignment:
| Q |
108 |
gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcactttaaaagtgttcctaatattgatatttttcttagaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||| |
|
|
| T |
36363871 |
gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcacttttaaggtattcctaatattgatatttttcttagaa |
36363970 |
T |
|
| Q |
208 |
agtttaagtagatatt |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36363971 |
agtttaagtagatatt |
36363986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University