View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_high_29 (Length: 371)
Name: NF7504_high_29
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 49252290 - 49252657
Alignment:
| Q |
1 |
cctctttttgtcacactcacaacatggtgggaattggcattttaattcgtgatgatcgtggccattttgtccaagccaaaactatccaagttacacctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49252290 |
cctctttttgtcacactcacaacatggtgggaattggcattttaattcgtgatgatcgtggccattttgtccaagccaaaactatccaagttacacctct |
49252389 |
T |
 |
| Q |
101 |
tttagaggttcaagaaggaaaggctaagggtctcttacatgctatgaattgggttattgagttgggtatggttaatgttgtttttgagcttgatgatgag |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49252390 |
tttacaggttcaagaaggaaaggctaagggtctcttacatgctatgaattgggttattgagttgggtatggttaatgttgtttttgagcttgatgatgag |
49252489 |
T |
 |
| Q |
201 |
actgtggttgatgcttttaatcatcccaaagatgatacttccctttttggctcaattatttaccaatgtcgtaatttagttgatcaaagtttaccaaact |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49252490 |
ac--tggttgatgcttttaatcatcccaaagatgatacttccctttttggctcaactatttaccaatgtcgtaatttagttgatcaaagtttaccaaact |
49252587 |
T |
 |
| Q |
301 |
caacagttgtgtttactaagaggatagcaaatagagcagctggtgtattagcaagtgttgctttagatat |
370 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49252588 |
caacagttgtgtttactaagaggaaagcaaatagagcagctggtgtattagctagtgttgctttagatat |
49252657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University