View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_high_32 (Length: 345)
Name: NF7504_high_32
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 4203102 - 4203378
Alignment:
| Q |
1 |
acaatcttgacaaactctatacttagaaccatacacaccattttcttcactctccatcatagcaatttttccatgattctcttcttcattgatcactccn |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4203102 |
acaatcttgacacactctatactcagaaccatacacaccattttcttcactctccatcatagcaatttttccatgattctcttcttcagtgatcactcct |
4203201 |
T |
 |
| Q |
101 |
nnnnnnggaagattcactacttcaggacacatcctaaggttccaaaaattgttattgttactaggattttcttgaacttcattgttttgagattgttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203202 |
ttttttggaagattcactacttcaggacacatcctaagattccaaaaattgttattgttactaggattttcttgaacttcattgttttgagattgttgtt |
4203301 |
T |
 |
| Q |
201 |
gtggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaaggaagctgatgaaggtaaagag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4203302 |
gtggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaatgaagctgatgaaggtaaagag |
4203378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University