View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_high_54 (Length: 265)
Name: NF7504_high_54
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 9604340 - 9604581
Alignment:
| Q |
1 |
aaattgatcaattcatatt-gaaatgtgtaaacttgaaaattgtaaaaacaaaaatataaatcactatttttgaccaaaacctttgttcggtcttgcagc |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9604340 |
aaattgatcaattcatatttgaaatgtgtaaacttgaaaattgtaaaaacaaaaatataaatcactatttttgaccaaaacctttgttc--------agc |
9604431 |
T |
 |
| Q |
100 |
caaaatgtgataaatattaagaaacaaatgtagtgaacgcttgagtgtaagtatgtgaccttccattgctccatgagcaacacatgaagtgtgtaagcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
9604432 |
caaaatgtgataaatattaagaaacaaatgtagtgaacgcttgagtgtatgtatgtgaccttccattgctccatgagcaacacatgaagtgcgtatgcat |
9604531 |
T |
 |
| Q |
200 |
gcacgcttggatcattggaacagcttggatctgtattgcagatatgagaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9604532 |
gcacgcttggatcattggaacagcttggatctgtattgcagatatgagaa |
9604581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University