View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_high_57 (Length: 256)
Name: NF7504_high_57
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_high_57 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 15030164 - 15030271
Alignment:
| Q |
1 |
taagaacttgataatatagaaatgatgcagaaaaagtatttttagagcctttttaatgttactatgttaaaagacatattgcctttactttttactcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15030164 |
taagaacttgataatatagaaatgatgcagaaaaagtatttttaaagcctttttaatgttactatgttaaaagacatattgcctttactttttactcttt |
15030263 |
T |
 |
| Q |
101 |
taaatctg |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
15030264 |
taaatctg |
15030271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 138988 - 138873
Alignment:
| Q |
125 |
tctcaagctcacataaggtgacaacaatttcattctgcaatgctcacaacttctcaggattgatgactttgctacatatagccttgaagaaaaaacatag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | || |||||||||||| | || ||||||||| | ||||| |||||||| ||||| || |
|
|
| T |
138988 |
tctcaagctcacataaggtgacaacaatttcattttgtagtgtcggcaacttctcagggtcaataactttgctagaaatagctttgaagaagaaacaaag |
138889 |
T |
 |
| Q |
225 |
tttagttatggtccat |
240 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
138888 |
tttagttatggtccat |
138873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 20750115 - 20750000
Alignment:
| Q |
125 |
tctcaagctcacataaggtgacaacaatttcattctgcaatgctcacaacttctcaggattgatgactttgctacatatagccttgaagaaaaaacatag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | || |||||||||||| | || ||||||||| | ||||| |||||||| ||||| || |
|
|
| T |
20750115 |
tctcaagctcacataaggtgacaacaatttcattttgtagtgtcggcaacttctcagggtcaataactttgctagaaatagctttgaagaagaaacaaag |
20750016 |
T |
 |
| Q |
225 |
tttagttatggtccat |
240 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20750015 |
tttagttatggtccat |
20750000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University