View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_19 (Length: 449)
Name: NF7504_low_19
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 17 - 432
Target Start/End: Complemental strand, 39313065 - 39312649
Alignment:
| Q |
17 |
atatttcagtactgttgatacattcagagattataatgacaccaccttgctcgttgtgggactaaattgacttatctggatggtaaatgtgttgatgata |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39313065 |
atatttcagtaatgttgatacattcagagattataatgacaccaccttgctcgttgtgggactaaattgacttatctggatggtaaatgtgctgatgata |
39312966 |
T |
|
| Q |
117 |
tatgtaaaaaatgtaggatgggacagaagtgcagcttaagtcagtggcattgcagaaatatgtatctgcagacaatgggggaggaatgaatgtgacagtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39312965 |
tatgtaaaaaatgtaggatgggacagaagtgcagcttaagtcagtgaaattgcagaagtatgtatctgcagacaatgggggaggaatgaatgtgacagtt |
39312866 |
T |
|
| Q |
217 |
gacagggatgccccatcttcatgggaaacgttcagggtaagatctaaagttgctatggtcttctattttaattttctatccagcattatatgttgcaatg |
316 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||| |||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39312865 |
gatagggatgccccatcttcatgggaaacattcagagtaagatctaaaattgccattgtcttctattttaattttctatccagcattatatgttgcaacg |
39312766 |
T |
|
| Q |
317 |
atttgattttttcagattaaggattatgtgtctaa-ttgtcagtccatttcctgtgcttactttatccatttcacggtttcatacctaaatcagttgaat |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39312765 |
atttgattttttcagattaaggattatgtgtctaatttgtcagtccatttcctgtgcttactttatccatttcacagtttcatacctaaatcagttgaat |
39312666 |
T |
|
| Q |
416 |
ttctgaatgtataaacg |
432 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39312665 |
ttctgaatgtataaacg |
39312649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University