View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_42 (Length: 331)
Name: NF7504_low_42
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_42 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 2221632 - 2221962
Alignment:
| Q |
1 |
caccttttcattagccttctcgctcttcattttctccatcttttgcaacatttccacaactccaacctcctttgccaccgccttaaacctcaatccacca |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2221632 |
caccttttctttagccttctcgctcttcattttctccatcttttgcaacatttccacaactccaacctcctttgccaccgccttaaacctcaatccgcca |
2221731 |
T |
 |
| Q |
101 |
tgactcaatgcatacaaaaccgcaacacaactctctttggtcgactcagactccaactcgttcccacacaataaacccaccaaacactccacaacacctg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2221732 |
tgactcaatgcatgcaaaaccgcaacacaactctctttggtcgactcagactccaactcgttcccacacaataaacccaccaaacactccacaacacctg |
2221831 |
T |
 |
| Q |
201 |
catccaacatagcagcccgaccatccgatccaaaccctaaattacccaacatcaacaaaacttgatccatcatatgacccgacttaaccatccccaacaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2221832 |
catccaacatagcagcccgaccatccgatccaaaccctaaattacccaacatcaacaaaacttgatccatcatatgacccgacttaaccatccccaacaa |
2221931 |
T |
 |
| Q |
301 |
aaccgagacaaaccctagcttaaccatctta |
331 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
2221932 |
aaccgaaacaaaccctagcttaaccatctta |
2221962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University