View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_45 (Length: 312)
Name: NF7504_low_45
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 33035420 - 33035124
Alignment:
| Q |
1 |
atgtcgttgtcatttggtttgttgtggatgtttagatatgtgtgggtttggttcatgctcaattctcgtggttgcttctttgacgaaagtgctggtttgg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33035420 |
atgtcgttgtcatttggttcgttgtggatgtttagatctgtgtgggtttggtttatgctcaattctcgtggttgcttctttgacgaaagtgctggtttgg |
33035321 |
T |
 |
| Q |
101 |
tgttcatcaatggttgggcttgctaggttatttcttccgctgtctttcgttgg-----------ttagtggttgaaatggttgctgctcttttgagagta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
33035320 |
tgttcatcaatggttgggcttgctaggtgatttcttccgctgtctttcgttggtctctatacaattagtggtggaagtggttgctgctcttttgagagta |
33035221 |
T |
 |
| Q |
190 |
ttgaaagggaggagattgggattgagtgtgttatttttctttaatgggtggttgaagaatgaaaggtcccataaagcgtgttggttgttaacggttt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
33035220 |
ttgaaagggaggagattgggattgagtgtgttaattttatttaatgggtggttgaagaatgaacggtcccataaagggtgttggttgttaacggttt |
33035124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University