View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_46 (Length: 310)
Name: NF7504_low_46
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 40016722 - 40017012
Alignment:
| Q |
1 |
aaacgattactcacgtgaattgctcacttatcacgtgtcttgaacagtgttagtttttgtgtgtgttacttgtactactttctcacacactataaactca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40016722 |
aaacgattactcacgtgaattgctcacttatcacgtgtcttgaacagtgttagtttttgtgtgtgttacttgtactactttctcacacactataaaccca |
40016821 |
T |
 |
| Q |
101 |
tctcaattgttagaatctcccaaatccttaacattttttcaacaccaacaatggcgaaaaacgttgcgattttcggtttattgttttctcttcttgcgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
40016822 |
tctcaattgttagaatctcccaaatccttaacattctttcaacaccaacaatggcgaaaaacgtttcgatttttggtttattgttttctcttcttgcgtt |
40016921 |
T |
 |
| Q |
201 |
ggttccttctcagatcttcgctgaggaatcatcaactgacgctaaggaatttgttcttacattggataacactaatttccatgatactgtt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40016922 |
ggttccttctcagatcttcgctgaggaatcatcaactgacgctaaggaatttgttcttacattggataacactaatttccatgatactgtt |
40017012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University