View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_52 (Length: 296)
Name: NF7504_low_52
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 277
Target Start/End: Original strand, 44136804 - 44137071
Alignment:
| Q |
8 |
cgaagaaaatagaggagttccgcaatgctatgtgtgatggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctctaattctacaagagga |
107 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44136804 |
cgaaaaaaatagaagagttccgcaatgctatgtgtgatggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctttaattctacaagagga |
44136903 |
T |
|
| Q |
108 |
aacttactggcgtcaacgttctaaggtctattggttagcagacggcgacactaatagcaagttcttccatgcctctgcttcggccaggaaaaggaaaaat |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44136904 |
aacttactggcatcaacgttctaaggtctattggttagtagacg--gacactaatagcaagttcttccatgcctctgcttcggccaggaaaaggaaaaat |
44137001 |
T |
|
| Q |
208 |
actattaagcaactgcgtgactcttcaggtaattggatcacttcgcaagaggatctttgcgcccttgttc |
277 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44137002 |
actattacgcaactgcgtgactcttcaggtaattggatcacttcgcaagaggatctttgcgcccttgttc |
44137071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 245
Target Start/End: Complemental strand, 27646348 - 27646231
Alignment:
| Q |
128 |
ctaaggtctattggttagcagacggcgacactaatagcaagttcttccatgcctctgcttcggccaggaaaaggaaaaatactattaagcaactgcgtga |
227 |
Q |
| |
|
||||||| ||||||||||| || ||||| ||||| ||||| || ||||| || || || || |||||||| |||||||| ||||| || | || ||||| |
|
|
| T |
27646348 |
ctaaggtttattggttagctgatggcgatactaacagcaaatttttccacgcatcagcatctgccaggaagaggaaaaacactataaaaaagcttcgtga |
27646249 |
T |
|
| Q |
228 |
ctcttcaggtaattggat |
245 |
Q |
| |
|
| | ||||| |||||||| |
|
|
| T |
27646248 |
cccatcaggcaattggat |
27646231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University