View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_53 (Length: 294)
Name: NF7504_low_53
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 45267546 - 45267817
Alignment:
| Q |
1 |
aaatctcaacaaatgactcgtaatataacgcaaatttttgcacaaattttcttgccaacaaaaatacacgtataatcaccacccagaaagaagnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45267546 |
aaatctcaacaaatgactcgtaatataacgcaaatttttgcacaaattttcttgccaacaaaaatacacgtataatcaccacccagaaaaaa-----aaa |
45267640 |
T |
|
| Q |
101 |
ntacacgtataatattctagtataaatttgaacatgcatgagtctggccttgttgatcatagactcagttcaatcacaaattatacaatctaccaccaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45267641 |
atacacgtataatattctagtataaatttgaacatgcatgagtctggccttgttgatcatacactcagttcaatcacaaattatacaatctaccaccaca |
45267740 |
T |
|
| Q |
201 |
acatccaaatactagcgaatcaattccctattagtacaacaagcaaatacttgtgaaccatgtccattcatgttatc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45267741 |
acatccaaatactagcgaatcaattccctattagtacaacaagcaaatacttgtgaaccatgtccattcatgttatc |
45267817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University