View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_58 (Length: 276)
Name: NF7504_low_58
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 2790667 - 2790417
Alignment:
| Q |
13 |
atgtcttaagtgaagttgcatcatcaagttcatcttcatcttcttctaatctcacaaggttaagctcgccgatttcgtactcctgcaacacttcacaagc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2790667 |
atgtcttaagtgaagttgcatcatcaagttcatcttcatcttcttctaatctcacaaggttaaactcgccgatttcgtactcctgcaacacttcacaagc |
2790568 |
T |
 |
| Q |
113 |
tcaaattaattctaactttgattggagtgattttcttcataatgatgagcctttagtgtggacagaaattcaacaaattcaacaatgtgacatacaaagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2790567 |
tcaaattaattctaactttgattggagtgattttcttcataatgatgagcctttagtgtggacagatattcaacaaattcaacaatgtgacatacaaagg |
2790468 |
T |
 |
| Q |
213 |
gtaatgtcatcattgaccctctcaggtataatgcaaaatgaaggtgaaatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2790467 |
gtaatgtcatcattgaccctctcaggtataatgcaaaatgaaggtgaaatt |
2790417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University