View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_62 (Length: 262)
Name: NF7504_low_62
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 31 - 246
Target Start/End: Complemental strand, 48149749 - 48149534
Alignment:
| Q |
31 |
tcttcttcataagtaaaaacctttaacccacacctcctatttactttgcnnnnnnncactttttgttcagattctttatctataaattctgctcagggaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48149749 |
tcttcttcataagtaaaaacctttaacccacacctcctatttactttgctttttttcactttttgttcagattctttatctataaattctgctcaggaaa |
48149650 |
T |
|
| Q |
131 |
ttaatatccttgtctaaggtttcttgggaaccacatcatcctgtcnnnnnnnnnnnnnnnnncctttaaaaacttctcaacaccacccatttttgtaaca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
48149649 |
ttaatatccttgtctaaggtttcttgggaaccacatcatcctgcctttttatttctttttttcctttaaaaacttctcaaccccccccatttttgtaaca |
48149550 |
T |
|
| Q |
231 |
cacaacaaaacggtca |
246 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
48149549 |
cataacaaaacggtca |
48149534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University