View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_68 (Length: 255)
Name: NF7504_low_68
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 242
Target Start/End: Original strand, 30652557 - 30652779
Alignment:
| Q |
24 |
atagtggtgcatatataatatatg----aacgtggttgtcatttgtttccttctttttagccattttgtgcattatgtgtttgataaccgttttgctaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652557 |
atagtggtgcatatataatatatgtatgaacgtggttgtcatttgtttccttctttttagccattttgtgcattatgtgtttgataaccgttttgctaaa |
30652656 |
T |
|
| Q |
120 |
gagactaggagccctttgattgttttccacccagcaccacttctaaaatttctccatcacgtttcatatccttttgtttaatcacaactcacaacacaga |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30652657 |
gagactagaagccctttgattgttttccacccagcaccacttctaaaatttctccatcacgtttcatatccttttgtttaatcacacctcacaacacagc |
30652756 |
T |
|
| Q |
220 |
tctactctttttgttgagatatt |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30652757 |
tctactctttttgttgagatatt |
30652779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University