View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7504_low_73 (Length: 248)
Name: NF7504_low_73
Description: NF7504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7504_low_73 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 34 - 248
Target Start/End: Original strand, 37583024 - 37583238
Alignment:
| Q |
34 |
gactcaaccttgtaaagataataatgttgcaataaatgaatgaatatacaagaaaacataataagggtacatatacatgctatgcatttgcaaaaagttg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37583024 |
gactcaaccttgtaaagataataatgttgcaataaatgaatgaatatacaagaaaacataataagggtacatatacatgctatgcatttgcaaaaagttg |
37583123 |
T |
 |
| Q |
134 |
ggagttggatttagtggaaatggttaaacttctacaatgtggtgaattaatattcgaattttagctttgagagatgctcacatctagtgtctaacagtgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37583124 |
ggagttggatttagtggaaatggttaaacttctacaatgtggtgaattaatattcgaattttagctttgagagatactcacatctagtgtctaacagtgt |
37583223 |
T |
 |
| Q |
234 |
atcaaatataatgat |
248 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37583224 |
atcaaatataatgat |
37583238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University