View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7506_high_20 (Length: 310)
Name: NF7506_high_20
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7506_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 134 - 296
Target Start/End: Original strand, 33032992 - 33033154
Alignment:
| Q |
134 |
ggaaccctaggttttggaatagtttctattgcacgtgcgtgttattctagggtttctctttcgtgacgcatttttcaccctgtatagggttttcaatcgg |
233 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032992 |
ggaaccctaggttttggaatagttactattgcacgtgcgtgtaattctagggtttctctttcgtgacgcatttttcaccctgtatagggttttcaatcgg |
33033091 |
T |
|
| Q |
234 |
ttcataaattcgtgcttaattctttggatggtttcgttaatcgattgttaagagtttcatcat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033092 |
ttcataaattcgtgcttaattctttggatggtttcgttaatcgattgttaagagtttcatcat |
33033154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 33032871 - 33032926
Alignment:
| Q |
18 |
gattaatcaaaatcactcactcgctttaaaaaactctctagggttatcgaaaccat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032871 |
gattaatcaaaatcactcactcgctttaaaaaactctctagggttatcgaaaccat |
33032926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University