View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7506_high_24 (Length: 244)
Name: NF7506_high_24
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7506_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 33033477 - 33033243
Alignment:
| Q |
10 |
atgcagaaccaccttcaccacccccaaccctaaaacaacaccgttgttatactctgaatactaacctaaactattcacccctcattttccctcagttcta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033477 |
atgcagaaccaccttcaccacccccaaccctaaaacaacaccgctgttatactctgaatactaacctaaactattcacccctcattttccctcagttcta |
33033378 |
T |
 |
| Q |
110 |
gaaaccctaaaaaattaatcccaaattcacggttgtaacggctccaacaacgccgcaatctcgaaacacaagacaatgccgtaaaggaaaaggttctcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33033377 |
gaaaccctaaaaaattaatcccaaattcacggttgtaacggctccaacaacgccgcaatctcgaaacacaagacaatgccgtaaaagaaaaggttctcta |
33033278 |
T |
 |
| Q |
210 |
aacctccatcttcaattagaaagattgattcaacc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033277 |
aacctccatcttcaattagaaagattgattcaacc |
33033243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University