View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7506_low_17 (Length: 341)
Name: NF7506_low_17
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7506_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 18 - 334
Target Start/End: Complemental strand, 48255537 - 48255221
Alignment:
| Q |
18 |
atttttgtctccaccattaatttcaacttactatttttatggtccaagaaaataaatattaactctatcaactgctgtctctgtatatcttggtatgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48255537 |
atttttgtctccaccattaatttcaacttactatttttatggtccaagaaaataaatattaactctatcaactgctatctctgtatatcttggtatgtga |
48255438 |
T |
|
| Q |
118 |
tgtcattcaccatgattagagacataatttaatggttgagagctatatataatttattaaacaatcaaacatttttatttatttgattctggcagctcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48255437 |
tgtcattcaccatgattagagacataatttaatggttgagagctatatatcatttattaaacaatcaaacatttatatttatttgattctggcagctcaa |
48255338 |
T |
|
| Q |
218 |
gctattggaattccatttttgagtccatatctacaatcaataggatcttattataaacatggagccaactatgctacattggcatccactgtgcttctac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255337 |
gctattggaattccatttttgagtccatatctacaatcaataggatcttattataaacatggagccaactatgctacattggcatccactgtgcttctac |
48255238 |
T |
|
| Q |
318 |
ctaatacttctttgttt |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48255237 |
ctaatacttctttgttt |
48255221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University