View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7506_low_22 (Length: 262)
Name: NF7506_low_22
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7506_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 176 - 247
Target Start/End: Original strand, 23119979 - 23120050
Alignment:
| Q |
176 |
tatatttttaggaatgtattcctctttattctccacatcctaatgacaatttggatatgatgatgattttga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23119979 |
tatatttttaggaatgtattcctctttattctccacatcctaatgacaatttggatatgatgatgattttga |
23120050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 176 - 247
Target Start/End: Original strand, 23104465 - 23104536
Alignment:
| Q |
176 |
tatatttttaggaatgtattcctctttattctccacatcctaatgacaatttggatatgatgatgattttga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23104465 |
tatatttttaggaatgtattcctctttattctccacatcctaatgataatttggatatgatgatgattttga |
23104536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University