View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7506_low_23 (Length: 255)
Name: NF7506_low_23
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7506_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 103 - 237
Target Start/End: Complemental strand, 17554250 - 17554118
Alignment:
| Q |
103 |
gacaagatacctaaactatttttgataagctcaaaaataggttaatctacttcttnnnnnnnngtaattaatttgtcnnnnnnnnnnnnttaaatctttt |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
17554250 |
gacaagatacctaaact--ttttgataagctcaaaaataggttaatctacttcttaaaaaaaagtaattaattttcaaaaaaaaagtaattaaatctttt |
17554153 |
T |
|
| Q |
203 |
tggcacactcgttctcttgtgtaaccttcccacaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17554152 |
tggcacactcgttctcttgtgtaaccttcccacaa |
17554118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 17554337 - 17554299
Alignment:
| Q |
18 |
gctaattcgtgtttcatcggtcaggtgtgcttagcacaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17554337 |
gctaattcgtgtttcatcggtcaggtgtgcttagcacaa |
17554299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University