View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7506_low_26 (Length: 244)

Name: NF7506_low_26
Description: NF7506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7506_low_26
NF7506_low_26
[»] chr3 (1 HSPs)
chr3 (10-244)||(33033243-33033477)


Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 33033477 - 33033243
Alignment:
10 atgcagaaccaccttcaccacccccaaccctaaaacaacaccgttgttatactctgaatactaacctaaactattcacccctcattttccctcagttcta 109  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33033477 atgcagaaccaccttcaccacccccaaccctaaaacaacaccgctgttatactctgaatactaacctaaactattcacccctcattttccctcagttcta 33033378  T
110 gaaaccctaaaaaattaatcccaaattcacggttgtaacggctccaacaacgccgcaatctcgaaacacaagacaatgccgtaaaggaaaaggttctcta 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
33033377 gaaaccctaaaaaattaatcccaaattcacggttgtaacggctccaacaacgccgcaatctcgaaacacaagacaatgccgtaaaagaaaaggttctcta 33033278  T
210 aacctccatcttcaattagaaagattgattcaacc 244  Q
    |||||||||||||||||||||||||||||||||||    
33033277 aacctccatcttcaattagaaagattgattcaacc 33033243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University