View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7508_high_13 (Length: 408)
Name: NF7508_high_13
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7508_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 109 - 392
Target Start/End: Original strand, 28611556 - 28611838
Alignment:
| Q |
109 |
gtgatttagagacttatgcgcaatgtgtttgccattgatgataacttgattaagagaggttttaatattgattcatatagcagcttgtgtgggaacaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28611556 |
gtgatttagagacttatgcgcaatgtgtttgccattgatgataacttgattaagagaggttttaatattgattcatgtagcagcttgtgtgggaacaatt |
28611655 |
T |
|
| Q |
209 |
atgaaattgcacatcatcnnnnnnncaatgtctatatactcttagatattggaattggttgtctgctttgttgggggtgcataatgatatatctagcttc |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28611656 |
atgaaattgcacatcatctttttttcaatgtctatatactcttagatattg-aattggttgtctgctttgttgggggtgcataatgatatatctagcttc |
28611754 |
T |
|
| Q |
309 |
acctatcttgtgtcaattatggatagaggttggagcccacaagcttgtgatctcatcttagccagttgtcatcatttatatttt |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28611755 |
acctatcttgtgtcaattatggatagaggttggagcccacaagcttgtgatctcatcttagctagttgtcatcatttatatttt |
28611838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 32 - 111
Target Start/End: Original strand, 28611430 - 28611509
Alignment:
| Q |
32 |
gatttaaatttgggttctcctacttttaaagatgattattttggccatactcataatctagttcttcttgatctactgtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28611430 |
gatttaaatttgggttctcctacttttaaagatgattattttggccatactcataatctagttcttcttgatctactgtg |
28611509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University