View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7508_high_20 (Length: 325)
Name: NF7508_high_20
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7508_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 232 - 307
Target Start/End: Complemental strand, 35965196 - 35965121
Alignment:
| Q |
232 |
tttcatcacaaaatcatcatgctgtaacatcttcttctgttagattctctcatcagtaattacctacctgttatct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965196 |
tttcatcacaaaatcatcatgctgtaacatcttcttctgttagattctctcatcagtaattacctacctgttatct |
35965121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 35965361 - 35965309
Alignment:
| Q |
67 |
atgcaactgcacgaacttcaaggcctttttctctgctcctctttttatgtcag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965361 |
atgcaactgcacgaacttcaaggcctttttctctgctcctctttttatgtcag |
35965309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University