View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7508_high_31 (Length: 222)

Name: NF7508_high_31
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7508_high_31
NF7508_high_31
[»] chr1 (2 HSPs)
chr1 (3-124)||(8794928-8795049)
chr1 (189-222)||(8795114-8795147)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 3 - 124
Target Start/End: Original strand, 8794928 - 8795049
Alignment:
3 aaccaaccactatcatatcacttttctttaaacttcttcatagagtattaacaaatnnnnnnnnnnttatggaaacctatcataacacttttccattaaa 102  Q
    |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
8794928 aaccaaccactatcatatcacttttcttcaaacttcgtcatagagtattaacaaataaataaaaaattatggaaacctatcataacacttttccattaaa 8795027  T
103 tactattatgcgtggtttgtcc 124  Q
     |||||||||| | ||||||||    
8795028 cactattatgcattgtttgtcc 8795049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 8795114 - 8795147
Alignment:
189 gctacaaactgtttttgtaagctatgtttgacca 222  Q
    |||||||||||||||| |||||||||||||||||    
8795114 gctacaaactgtttttataagctatgtttgacca 8795147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University