View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7508_high_31 (Length: 222)
Name: NF7508_high_31
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7508_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 3 - 124
Target Start/End: Original strand, 8794928 - 8795049
Alignment:
| Q |
3 |
aaccaaccactatcatatcacttttctttaaacttcttcatagagtattaacaaatnnnnnnnnnnttatggaaacctatcataacacttttccattaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8794928 |
aaccaaccactatcatatcacttttcttcaaacttcgtcatagagtattaacaaataaataaaaaattatggaaacctatcataacacttttccattaaa |
8795027 |
T |
|
| Q |
103 |
tactattatgcgtggtttgtcc |
124 |
Q |
| |
|
|||||||||| | |||||||| |
|
|
| T |
8795028 |
cactattatgcattgtttgtcc |
8795049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 8795114 - 8795147
Alignment:
| Q |
189 |
gctacaaactgtttttgtaagctatgtttgacca |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
8795114 |
gctacaaactgtttttataagctatgtttgacca |
8795147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University