View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7508_low_20 (Length: 325)

Name: NF7508_low_20
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7508_low_20
NF7508_low_20
[»] chr5 (2 HSPs)
chr5 (232-307)||(35965121-35965196)
chr5 (67-119)||(35965309-35965361)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 232 - 307
Target Start/End: Complemental strand, 35965196 - 35965121
Alignment:
232 tttcatcacaaaatcatcatgctgtaacatcttcttctgttagattctctcatcagtaattacctacctgttatct 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35965196 tttcatcacaaaatcatcatgctgtaacatcttcttctgttagattctctcatcagtaattacctacctgttatct 35965121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 35965361 - 35965309
Alignment:
67 atgcaactgcacgaacttcaaggcctttttctctgctcctctttttatgtcag 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
35965361 atgcaactgcacgaacttcaaggcctttttctctgctcctctttttatgtcag 35965309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University