View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7508_low_29 (Length: 236)
Name: NF7508_low_29
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7508_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 28 - 218
Target Start/End: Original strand, 38932026 - 38932216
Alignment:
| Q |
28 |
tgaatcatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
127 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932026 |
tgaatgatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
38932125 |
T |
 |
| Q |
128 |
tattggaagtgtcgaggagagtgacaataataagcggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932126 |
tattggaagtgtcgaggagagtgacaataataagaggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataag |
38932216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University