View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7508_low_31 (Length: 225)
Name: NF7508_low_31
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7508_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 8795817 - 8795611
Alignment:
| Q |
1 |
agtgaaaattcaattgagattttactagaacttacctgaggaaagatgaaggagttttagggttttgtggagattgcaacgatgaacaatgctctctaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8795817 |
agtgaaaattcaattgagattttactagaacttacctgaggaaagatgaaggagttttagggttttgtggagattgcaacgatgaacaatg--ctctaag |
8795720 |
T |
 |
| Q |
101 |
atttcttaggtttgagtagcgcgaatgtagaaaacacgaatagcgctaaatatagagaggtttgaatgggctttatttaaagctcaaatttcgtgatatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8795719 |
atttcttaggtttgagtagcgcgaatgtagaaaacacgaatagtgctaaatat--agaggtttgaatgggctttatttaaagctcaaatttcgtgatatt |
8795622 |
T |
 |
| Q |
201 |
gttatgaatta |
211 |
Q |
| |
|
|||| |||||| |
|
|
| T |
8795621 |
gttaagaatta |
8795611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University