View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7508_low_34 (Length: 202)

Name: NF7508_low_34
Description: NF7508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7508_low_34
NF7508_low_34
[»] chr1 (1 HSPs)
chr1 (91-165)||(10285738-10285812)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 91 - 165
Target Start/End: Complemental strand, 10285812 - 10285738
Alignment:
91 tggtttaatgttgtcgtacaacaagtgacgacgttgaattaccagaaaattaatgataagagaatgatgtgtgtg 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
10285812 tggtttaatgttgtcgtacaacaagtgacgacgttgaattaccagaaaattaataataagagaatgatgtgtgtg 10285738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University