View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7510_low_2 (Length: 333)
Name: NF7510_low_2
Description: NF7510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7510_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 34620840 - 34620623
Alignment:
| Q |
13 |
aatatctagctaggacaataaaagaacaagatacaagtactttaaaaggaaatcattgttattttggtaagtgaaggtccttttcccttgccccccatga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34620840 |
aatatctagctaggacaataaaagaacaagatacaagtactttaaaaggaaatcattgttattttggtaagtgaaggtccttttcccttgccccccatgg |
34620741 |
T |
|
| Q |
113 |
cattggcggccaactgaaggataaagataattattattttgaatttatgtccaccacctcaatgttcaagctttgtcaatgccgcgatataatggtgttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34620740 |
cattggcggccaactgaaggataaagataattattattttgaatttatgtccaccacctcaatgttcaagctttgtcaatgccgcgatataatggtgtta |
34620641 |
T |
|
| Q |
213 |
catacggcctcctactac |
230 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
34620640 |
cgtacggcctcctactac |
34620623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University