View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7511_high_5 (Length: 298)
Name: NF7511_high_5
Description: NF7511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7511_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 7 - 277
Target Start/End: Complemental strand, 47599504 - 47599234
Alignment:
| Q |
7 |
atggacatcaacaaccaaatcagacctaacaatccctctaaccatcatgtgcacaccactctcccaacacggcactgacctacctcttctcccttacgat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599504 |
atggccatcaacaaccaaatcagacctaacaatccctctaaccatcatgtgcacaccactctcccaacacggcactgacctacctcttctcccttacgat |
47599405 |
T |
 |
| Q |
107 |
cctctcctctgcactcgatgcggcgccgttttaaacccttacgctcgtctcgattatcaatcacgtatctggcactgtcccttttgttctcaacgaaacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599404 |
cctctcctctgcactcgatgcggcgccgttttaaacccttacgctcgtctcgattatcaatcacgtatctggcactgtcccttttgttctcaacgaaacc |
47599305 |
T |
 |
| Q |
207 |
cttttcctcgctccatcgccgacgctaatcttcccgctgaactctttcctacttacaccactgttgaatac |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599304 |
cttttcctcgctccatcgccgacgctaatcttcccgctgaactctttcctacttacaccactgttgaatac |
47599234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University