View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7511_low_6 (Length: 296)
Name: NF7511_low_6
Description: NF7511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7511_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 82 - 280
Target Start/End: Complemental strand, 37137006 - 37136808
Alignment:
| Q |
82 |
attgcaagaaatacttctaccttccatcacaagatcatccaaaagtccactattttttccatcatgtgataatggtgcaacttcatagtaatcattaacc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37137006 |
attgcaagaaatacttctaccttccatcacaagatcgtccaaaagtccactattttttccatcatgtgataatggtgcaacttcatagtaatcattaacc |
37136907 |
T |
 |
| Q |
182 |
atgcttgaatttcccataaaattaccatcaactccactagcataagatgaagcaggagtttcagaatcatacagagatcctgcattgaatccatgatgt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136906 |
atgcttgaatttcccataaaattaccatcaacgccactagcataagatgaagcaggagttttagaatcatacagagatcctgcattgaatccatgatgt |
37136808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 51
Target Start/End: Complemental strand, 37137053 - 37137007
Alignment:
| Q |
5 |
tattcttcaccctccatatttttcctcttatgagatacatccccctt |
51 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37137053 |
tattcttcaccctccatgtttttcctcttatgagatacatccccctt |
37137007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University