View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7513_high_6 (Length: 249)
Name: NF7513_high_6
Description: NF7513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7513_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 54456838 - 54457049
Alignment:
| Q |
19 |
gaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccgatgatgatgatgaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456838 |
gaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccgatgatgatgatgaacc |
54456937 |
T |
|
| Q |
119 |
ctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456938 |
ctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtgacaaggacaaagttattctattggtcagtttcgtaactttttc |
54457037 |
T |
|
| Q |
219 |
tattctcttctc |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54457038 |
tattctcttctc |
54457049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 54056517 - 54056601
Alignment:
| Q |
19 |
gaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
54056517 |
gaagtgaggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctacaccga |
54056601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 54056600 - 54056661
Alignment:
| Q |
168 |
gaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttct |
229 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
54056600 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctactcttttct |
54056661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 229
Target Start/End: Complemental strand, 15039809 - 15039756
Alignment:
| Q |
177 |
caaggacaaagttattctattggtca-gtttcgtaactttttctattctcttct |
229 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
15039809 |
caaggacaaaattattctattggtaaagtttcataactttttctattctcttct |
15039756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 15039936 - 15039895
Alignment:
| Q |
26 |
ggagggagcttgcaatggagggggcgtttggaactatgcaga |
67 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
15039936 |
ggagggagcttgcaatggagaggacgtttggaaccatgcaga |
15039895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University