View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7513_high_8 (Length: 229)
Name: NF7513_high_8
Description: NF7513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7513_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 40193084 - 40193284
Alignment:
| Q |
17 |
atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttatttttgacaaatttttgataaatcgattgtcaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193084 |
atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttttttttgacaaatttttgataaatcgattgtcaatt |
40193183 |
T |
|
| Q |
117 |
agattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctcacttcttga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193184 |
agattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctcacttcttga |
40193283 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
40193284 |
t |
40193284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University