View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7513_low_9 (Length: 229)

Name: NF7513_low_9
Description: NF7513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7513_low_9
NF7513_low_9
[»] chr3 (1 HSPs)
chr3 (17-217)||(40193084-40193284)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 40193084 - 40193284
Alignment:
17 atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttatttttgacaaatttttgataaatcgattgtcaatt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
40193084 atatcacgtccttagtcttactaaaagctaaatgaatattagcacttttttgataaatcgatttttttttgacaaatttttgataaatcgattgtcaatt 40193183  T
117 agattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctcacttcttga 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40193184 agattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctcacttcttga 40193283  T
217 t 217  Q
    |    
40193284 t 40193284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University