View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7514_high_12 (Length: 250)
Name: NF7514_high_12
Description: NF7514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7514_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 53 - 163
Target Start/End: Complemental strand, 19974300 - 19974190
Alignment:
| Q |
53 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacaaactgtttagaaacaaaaataggaattgctacttcgggaactatcatag |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19974300 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacacactttttagaaacaaaaataggaattgccactttgggaactatcatag |
19974201 |
T |
|
| Q |
153 |
attgctactat |
163 |
Q |
| |
|
| |||||||| |
|
|
| T |
19974200 |
ctagctactat |
19974190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 19973996 - 19973949
Alignment:
| Q |
188 |
tcatctagttctgaatttcagttgctttggtgattttaatttcttgat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19973996 |
tcatctagttctgaatttcagttgctttggtgattttagtttcttgat |
19973949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University