View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7514_low_14 (Length: 250)

Name: NF7514_low_14
Description: NF7514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7514_low_14
NF7514_low_14
[»] chr5 (2 HSPs)
chr5 (53-163)||(19974190-19974300)
chr5 (188-235)||(19973949-19973996)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 53 - 163
Target Start/End: Complemental strand, 19974300 - 19974190
Alignment:
53 accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacaaactgtttagaaacaaaaataggaattgctacttcgggaactatcatag 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||||||    
19974300 accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacacactttttagaaacaaaaataggaattgccactttgggaactatcatag 19974201  T
153 attgctactat 163  Q
     | ||||||||    
19974200 ctagctactat 19974190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 19973996 - 19973949
Alignment:
188 tcatctagttctgaatttcagttgctttggtgattttaatttcttgat 235  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||    
19973996 tcatctagttctgaatttcagttgctttggtgattttagtttcttgat 19973949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University