View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7514_low_19 (Length: 234)
Name: NF7514_low_19
Description: NF7514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7514_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 54010492 - 54010707
Alignment:
| Q |
1 |
agttgattgatttgcttacctcacagcaaccaagaccttccacgtcttctggtaatctcatggctgctagatcaccataagtacaatctcttctgaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54010492 |
agttgattgatttgcttacctcacagcaaccaagaccttccacgtcttctggtaatctcatggctgctagatcaccataagtacaatctcttctgaatga |
54010591 |
T |
 |
| Q |
101 |
taaaattggtgggacaacaaattgatgaaaatgggttccacttggtgcccaactttgctctcttggtgttatccacttgccaacaatccaggcctgtatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54010592 |
taaaattggtgggacaacaaattgatgaaaatgggttccacttggtgcccaactttgctctcttggtgttatccacttgccaacaatccaggcctgtatc |
54010691 |
T |
 |
| Q |
201 |
aagacatgtaaccatt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54010692 |
aagacatgtaaccatt |
54010707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University