View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7515_low_4 (Length: 418)
Name: NF7515_low_4
Description: NF7515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7515_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 183 - 400
Target Start/End: Original strand, 42790083 - 42790296
Alignment:
| Q |
183 |
aatcatgagataagttctcaacgtaatattaaagaaagtatataaagttctccatgtaataatagtaatgcataaatgtgaagagtaatttgattaaaga |
282 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42790083 |
aatcattagataagttctcaacgtaatattattaat----tataaagttctccatgtaataatagtaatgcgtaaatgtgaagagtaatttgattaaaga |
42790178 |
T |
 |
| Q |
283 |
acggggtgttcacaaaccggattggctcagttttggctgatcaaatttgttcatccaatttaaaaattgtaagatacttattagatatgtttagatgaat |
382 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42790179 |
atggggtgttcacaaaccagattggctcagttttggctgatcaaatttgttcatcaaatttaaaaattgtaagatacttattagatatgtttagatgaat |
42790278 |
T |
 |
| Q |
383 |
gtttaatgagcttttagg |
400 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42790279 |
gtttaatgagcttttagg |
42790296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University