View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7515_low_7 (Length: 252)
Name: NF7515_low_7
Description: NF7515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7515_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 41668563 - 41668357
Alignment:
| Q |
16 |
aatatttaacaattagaaacaaacaaaaattaacatgcttctaataattttgtaaaggattgatatcaatcactctcgtagtcacttgaccagaaggaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668563 |
aatatttaacaattagaaacaaacaaaaattaacatgcttctaataattttgtaaaggattgatgtcaatcactctcgtagtcacttgaccagaaggaat |
41668464 |
T |
 |
| Q |
116 |
ccatc---taatcgtttcacacagtaaagtgtgagagttatcgaaatagaagaggcgctcgtaacctatatagagcatccatactcgatgctagctagtc |
212 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668463 |
ccatctaataattgtttcacacagtaaagtgtgagagttatcgaaatagaagaggcgctcgtaacctatatagagcatccatactcgatgctagctagtc |
41668364 |
T |
 |
| Q |
213 |
tcacaat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
41668363 |
tcacaat |
41668357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University