View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7517_low_4 (Length: 267)
Name: NF7517_low_4
Description: NF7517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7517_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 148 - 267
Target Start/End: Complemental strand, 8817236 - 8817117
Alignment:
| Q |
148 |
cttcttcttttgacatgggagcacggaattttagacttttaggtgtgaagatgatttgtcaatagttgttaatcacaggtcactcaaagtctcaagtatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8817236 |
cttcttcttttgacatgggagcacggaattttagacttttaggtgtgaagatgatttgtcaatagttgttaatcacaggtcactcaaagtctcaaatatg |
8817137 |
T |
 |
| Q |
248 |
aaataagttgtctatgtatt |
267 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8817136 |
aaataagttgtctatgtatt |
8817117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 49328208 - 49328068
Alignment:
| Q |
1 |
ttcacattttgagcttttaccaattnnnnnnn-cattatgagctatcgatcgactgtctagctaaatatggaactcgtgcaatgattgttttcgtctatt |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49328208 |
ttcacattttgagcttttaccaattaaaaaaaacattatgagctattgatcgactgtccagctaaatatggaactcgtgcaatgattgttttcgtctatt |
49328109 |
T |
 |
| Q |
100 |
ataagttgattgattctcctatatagttgattgattttgag |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49328108 |
ataagttgattgattctcctatatagttgattgattttgag |
49328068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University