View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7517_low_6 (Length: 241)
Name: NF7517_low_6
Description: NF7517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7517_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 36601505 - 36601304
Alignment:
| Q |
21 |
ttttaggattgccatataatttgaattaagggttaatatgcctttagcggaatcttattctgctgttaataatgaattttacctatagtctgtgctaaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36601505 |
ttttaggattgccatataatttgaattaagggttaatatgcttttaggggaatcttattctgctgttaataatgaattttacctatagtccttgctaaca |
36601406 |
T |
 |
| Q |
121 |
attcacaagctagaatataaagttcttcgatgccctaataaaagccatcatttgaaaacaaaccacataccggctgtttagaatggcagttgtcaaacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36601405 |
attcacaagctagaatataaagttcttcgatg-cctaataaaagccatcatttgaaaacaaaccacataccggctgtttagaacggcagttgtcaaacat |
36601307 |
T |
 |
| Q |
221 |
gat |
223 |
Q |
| |
|
||| |
|
|
| T |
36601306 |
gat |
36601304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University