View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7518_low_2 (Length: 304)
Name: NF7518_low_2
Description: NF7518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7518_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 143 - 280
Target Start/End: Complemental strand, 45850557 - 45850420
Alignment:
| Q |
143 |
aagtattgcatttccttaccttttactttaatttagaagagcgaatgtcacataaaatgttgctaaaagagtgttcatttctcataacatcaatacaaca |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45850557 |
aagtattgcatttccttaccttttactttaatttcgaagagcgaatgtcacataaaatgttgctaaaagagtgttcatttctcataacatcaatacaaca |
45850458 |
T |
|
| Q |
243 |
atgtcatctagcaaaggcaaggaaataaacagattaag |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45850457 |
atgtcatctagcaaaggcaaggaaataaacaaattaag |
45850420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 45850699 - 45850670
Alignment:
| Q |
1 |
gccatgatcaaaatccaaaaatgagagacc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45850699 |
gccatgatcaaaatccaaaaatgagagacc |
45850670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University