View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7520_high_12 (Length: 202)
Name: NF7520_high_12
Description: NF7520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7520_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 38 - 188
Target Start/End: Original strand, 41668119 - 41668269
Alignment:
| Q |
38 |
cattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatgagtagtaaccttcaacccaaatcttgcccaacat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668119 |
cattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatgagtagtaaccttcaacccaaatcttgcccaacat |
41668218 |
T |
|
| Q |
138 |
tgtgccatcatagctaggccggtaggcccttcctttctccgcaagaataat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668219 |
tgtgccatcatagctaggccggtaggcccttcctttctccgcaagaataat |
41668269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University