View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7520_high_7 (Length: 259)
Name: NF7520_high_7
Description: NF7520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7520_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 8143142 - 8142899
Alignment:
| Q |
16 |
atcatgaataaataagggaataagtaggttcacagctaggcaggagggttaaccgacacattcggagtgagtctgaattgtgaaacagttggaacaaaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8143142 |
atcatgaataaataagggaataagtaggttcccagctaggcaggagggttaaccgacacattaggagtgagtctgaattgtgaaacagttggaacaaaag |
8143043 |
T |
 |
| Q |
116 |
ttgttagattttgatgacttttcttattacaaaatatactaaaaataaattggtttctagtctcttacgttagaacaaaaaagagtgaatgagtgagagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8143042 |
ttgttagattttgatgacttttcttattacaaaatatactaaaaataaattggtctctagtctcttacgttagaacaaaaaagagtgaatgagtgagagt |
8142943 |
T |
 |
| Q |
216 |
gttgtgtggtgtcaccataaccttaaccccttcaccattctcat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8142942 |
gttgtgtggtgtcaccataaccttaaccccttcaccattctcat |
8142899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University