View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7520_low_9 (Length: 254)
Name: NF7520_low_9
Description: NF7520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7520_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 5155032 - 5154941
Alignment:
| Q |
151 |
gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5155032 |
gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtct |
5154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Complemental strand, 5155161 - 5155129
Alignment:
| Q |
20 |
gctgttaccggactattcaatatcctgattcgg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5155161 |
gctgttaccggactattcaatatcctgattcgg |
5155129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University