View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_high_10 (Length: 414)
Name: NF7523_high_10
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 19 - 396
Target Start/End: Original strand, 43789140 - 43789518
Alignment:
| Q |
19 |
cccaggtgtatttatcgcatacattaccacagatgccgtttgaggtaatggtgccggagttta--acatgctggtgatgtcgtcgggatttttctcgaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| || ||| |||||||||||||||||||||||| |
|
|
| T |
43789140 |
cccaggtgtatttatcgcatacattaccacagatgacgtttgaggtaatggtgccggagtttataacacgccggt-atgtcgtcgggatttttctcgaca |
43789238 |
T |
 |
| Q |
117 |
aatacattaccaccgatgccgtttgaggtctttcccaccgttacaagcatgcagtcgcagacggtggtatctttcaatgacgtttggcctgggaataaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789239 |
aatacattaccaccgatgccgtttgaggtctttcccacagttacaagcatgcagtcgcagacggtggtatctttcaatgacgtttggcctgggaataaca |
43789338 |
T |
 |
| Q |
217 |
tctctgcaagtccgtcgaattttcttcccagcgacgttgttccgccgcagatgccaccgaaccagttcagttcttttgatttcgactaagtttatttctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789339 |
tctctgcaagtccgtcgaattttcttcccagcgacgttgttccgccgcagatgccaccgaaccagttcagttcttttgatttcgactaagtttatttctt |
43789438 |
T |
 |
| Q |
317 |
cttgttctttcatacattcattatattctctttagttatgtttgtgtcgggagaatacaacactcctttagtgggttttc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789439 |
cttgttctttcatacattcattatattctctttagttatgtttgtgtcgggagaatacaacactcctttagtgggttttc |
43789518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University