View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_high_36 (Length: 280)
Name: NF7523_high_36
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 261
Target Start/End: Complemental strand, 31960350 - 31960174
Alignment:
| Q |
90 |
tacaatggaatttgggaagtaagagaaatattatttttaataaaaaatttccatttcttgtttttgttaaag-----agtgctccaagaacatcgattaa |
184 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31960350 |
tacaatggaatttggaaagtaagagaaatattatttttaataaaaaatttccattttttgtttttgttaaagctaagagtgctccaagaacatcgattaa |
31960251 |
T |
 |
| Q |
185 |
tatgactcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatca |
261 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31960250 |
tatgacgcataaaacaatatcacaaggtaagaaaagttaccgatacgacatcacccaatgtagttttctgcagatca |
31960174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University