View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_high_46 (Length: 249)
Name: NF7523_high_46
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 38325400 - 38325638
Alignment:
| Q |
1 |
tagtatcctctgttgctctcttcctatgtgattgagttttatttctatccaagttattttcatacaattatgtttgaattcactaggttaaactgtattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325400 |
tagtatcctctgttgctctcttcctatgtgattgagttttatttcaatcgaagttattttcatacaattatgtttgaattcactaggttaaactgtattc |
38325499 |
T |
 |
| Q |
101 |
aattttttggcatgtaatccctttgattcaatttcaaaacgatttttctttggcgtatacctgtttaaaagttttatttatattcgtcaggaatgtaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38325500 |
aattttttggcatgtaatccctttgattcaatttcaaaatgatttttctttggcgtatacctgtttaaaagttgtatttatattcgtcaggaatgtaatc |
38325599 |
T |
 |
| Q |
201 |
agtgctcaaagcaaacgggaaaatgctgccctgatgtcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38325600 |
agtgctcaaagcaaacgggaaaatgctgccctgctgtcc |
38325638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University