View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7523_high_55 (Length: 235)
Name: NF7523_high_55
Description: NF7523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7523_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 33985529 - 33985723
Alignment:
| Q |
19 |
aatcgaatactcaccaccatttttcacctgcaagtaacaataacatcataattcaagaacaaggaaacccagaattcgaatgaacaataacatattaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985529 |
aatcgaatactcaccaccatttttcacctgcaagtaacaataacatcataattcaagaacaaggaaacccagaattcgaatgaacaataacatattaaac |
33985628 |
T |
 |
| Q |
119 |
tatttttcagtgttttgaaattgaagaaaaggttgagaaggaagagagaagaaacgaacctggctggttgggttcgaaggaacaatgaatgaatg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33985629 |
tatttttgagtgttttgaaattgaagaaaaggttgagaaggaagagagaagaaacgaacctggctggttgggttcgatggaacaatgaatgaatg |
33985723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University